UNC1999

Methyltransferase-Aktivitätsassays werden durch Überwachung des Einbaus einer tritiummarkierten Methylgruppe aus S-Adenosylmethionin (3H-SAM) in biotinylierte Peptidsubstrate unter Verwendung des Scintillation Proximity Assay (SPA) für den PRC2-EZH2-Trimerkomplex (EZH2:EED:SUZ12), den PRC2-EZH1-Pentamerkomplex (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, den MLL1-Tetramerkomplex (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50-Komplex und SMYD2 durchgeführt. Der Reaktionspuffer für SMYD2 und SMYD3 ist 50 mM Tris pH 9,0, 5 mM DTT, 0,01 % TritonX-100; für G9a, GLP und SUV39H2 ist 25 mM Kaliumphosphat pH 8,0, 1 mM EDTA, 2 mM MgCl₂ und 0,01 % Triton X-100; und für andere HMTs 20 mM Tris pH 8,0, 5 mM DTT, 0,01 % TritonX-100. Um die enzymatischen Reaktionen zu stoppen, werden 10 μL 7,5 M Guanidinhydrochlorid hinzugefügt, gefolgt von 180 μL Puffer, gemischt und auf eine 384-Well-FlashPlate übertragen. Nach dem Mischen werden die Reaktionsgemische inkubiert und die CPM-Werte mit einem Topcount-Plattenlesegerät gemessen. Die CPM-Werte ohne diese Verbindung für jeden Datensatz werden als 100 % Aktivität definiert. Ohne das Enzym werden die CPM-Werte in jedem Datensatz als Hintergrund (0 %) definiert. IC50-Werte werden unter Verwendung von Verbindungskonzentrationen im Bereich von 100 nM bis 100 μM bestimmt. Die IC50-Werte werden mit der SigmaPlot-Software bestimmt. EZH2-Y641F-Assays werden unter Verwendung von 30 nM Enzym in 20 mM Tris pH 8, 5 mM DTT, 0,01 % Triton X-100, 5 μM SAM und 1 μM H3 (1-24)-Peptid (wie für den Wildtyp-PRC2-EZH2-Komplex) durchgeführt. Für DNMT1 wird der Assay unter Verwendung von hemimethylierter dsDNA als Substrat durchgeführt. Das dsDNA-Substrat wird durch Annealing zweier komplementärer Stränge (biotinylierter Vorwärtsstrang: BGAGCCCGTAAGCCCGTTCAGGTCG und Reverse-Strang: CGACCTGAACGGGCTTACGGGCTC), synthetisiert von Eurofins MWG Operon, hergestellt. Der Reaktionspuffer ist 20 mM Tris-HCl, pH 8,0, 5 mM DTT, 0,01 % Triton X-100. Methyltransferase-Aktivitätsassays für DOT1L werden unter Verwendung von Filterplatten durchgeführt. Reaktionsgemische in 20 mM Tris-HCl, pH 8,0, 5 mM DTT, 2 mM MgCl₂ und 0,01 % Triton X-100 werden 1 Stunde bei Raumtemperatur inkubiert, 100 μL 10 % TCA werden hinzugefügt, gemischt und auf eine Filterplatte übertragen. Die Platten werden 2 Minuten bei 2000 U/min zentrifugiert, gefolgt von 2 weiteren 10 % TCA-Wäschen und einer Ethanolwäsche (180 μL) gefolgt von Zentrifugation. Die Platten werden getrocknet und 100 μL MicroO werden hinzugefügt und zentrifugiert. 70 μL MicroO werden hinzugefügt und die CPM-Werte werden mit einem Topcount-Plattenlesegerät gemessen.

DLBCL cell line harboring the EZH2Y641N mutant

~5 μM

8 days

DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3.

Male Swiss albino mice

~150 mg/kg (i.p.), ~50 mg/kg (oral)

Intraperitoneal administration or oral administration